Saturday, October 5, 2019

Data analysis report Lab Example | Topics and Well Written Essays - 2750 words - 1

Data analysis - Lab Report Example According to Ajzen (1988); Ajzen (1991); O’Donnel et al. (1994) and Conner (1993), a persons planned behaviour change has a significant contribution to his/her attitudes towards various conditions. Further, to them, the success of the planned behaviour significantly depends on the social-economic situation of the person in the past, present and future aspirations. Ajzen and Driver (1991: 1992); Ajzen and Fishbein (1980); Dejoy and Wilson (1995); DeVellis et al. (1990) and Newcomb et al. (1992) support the above assertions arguing that if one plans to do away of a certain behaviour, then there are strings attached which range from financial stability to family cohesion. Further, intentions and wishes to abandon a certain habit depend on time and gender. From research, time affects any outcome since other factors come into play which might significantly affect the results or influence earlier readings/measurements. The way a person acts now has a significant bearing on how he/she will react in the near future as well as in a distant future. Godin et al. (1993); Adams (1994); Godin (1993) and Heatherton et al. (1991) argue that time lapse has effects not only on the results but also on the validity and reliability of research findings. This is so because of factorial design impacts on the end-term outcome. Gender on the other hand is a very important aspect to consider in planned behaviour changes as it is believed that females are better and more confident to follow a rule they had set than males as the later are easy to influence and change their track than females. Hellman et al. (1991); Godin et al. (1992); Liska (1984); MacKay (1994) and Joreskog and Sorbom (1993) is support of the above argument argue that females are more likely to convince of the negative impact of an habit than their male counterparts since they are most likely to give it a hearing

Friday, October 4, 2019

Northern Cape Department of Educations Service Standards Research Proposal

Northern Cape Department of Educations Service Standards - Research Proposal Example From this study it is clear that  the turnaround strategy when implemented tries to bring the distressed and underperforming departments back into normal performing setup. The acceptable level of solvency, liquidity, profitability, and cash flow are the basic objectives of a turnaround strategy. The management also try to focus on certain turnaround strategy components like managing, funding, stabilising, fixing of the distressed components to revert back the organisation to working profitably and also to bring back stability into the associated activities of the department. The service standard of the organisation holds the key in judging their capability and analysing their success. In this dissertation also, the success of the department is aimed to be judged on their performance after the turnaround strategy.According to the report  the Northern Cape Education Department (NCED) has moved from an effective and efficient department, to one with many management challenges. In 20 06, the Northern Cape boasted the best matric pass rate, with good financial and administrative systems and reports. In response of this reality, the NCED did adopt a two-pronged approach for the service delivery and also for meeting its performance obligations. The department is faced with a massive task of restoring its sound financial and administrative position. The internal clients’ belief towards the department and its capability of handling any such issues brings back stability in the entire departmental structure.

Thursday, October 3, 2019

My Production of Act 1 Essay Example for Free

My Production of Act 1 Essay My production of this scene will be performed in the round, with the audience seats rising outwards as if looking in to a pit. The stage itself will have a single light shining brightly from the centre straight up into a gap in the ceiling. The performance will be set in the main hallway of an expansive mansion, with the dim outlines of a staircase in the backgrounds, but the lighting will be very poor apart from the centre stage light. The beginning of the play will begin with complete pitch dark, so as to scare the audience, and to open their minds to all the possible evils in the eye of the imagination. The half-light will semi-illuminate the background and then the flash of the centre stage light will shock them, as the unexplainable phenomenon of thunder that Shakespeare used to show evil in his script, as the people of that time were very apprehensive about thunder and lightning, and believed witches could control the weather, inspiring the fear of power. As the thunder, a corpse will come dropping like only a corpse knows how, through the roof and onto the light, causing semi-darkness once more. As the audience are examining the corpse while trying not to look too closely, the flash of steel from the long, thin dagger straight to its target, will give the audience a presence of true sadism, a torturer who does not know when to stop, a merciless twisted mind. As the blade hits the torso of the stiff, a soft thud will horrify the audience, as to how easily the knife cut through it, right to the hilt. This will serve as a warning as to what they are going to witness, much like the summary of the play before it was performed in Shakespeares day, only simpler. The entrance of the evil coven will be dramatic, although not from a trapdoor, like Shakespeare would have done creating the image of an entry from hell. The assassins, all clad in black tight fitting suits which cover their faces, introducing the image of deception and battle with knives almost all over them, and each having six fingers on their left hand, showing disease and evil, as the people in that day believed left handed people were evil. The assassins will use ropes to descend, and each will be at a different third of the stage facing each of the thirds of the audience, giving them a long and contemptuous look, and stating their unchallenged superiority of them all. As they chant, their voices merging into one, purple smoke will swirl inwards as the gathering of evil. Shakespeare would have just used the witches voices becoming one to show the power of evil being gathered, As now more technology is available than in Shakespeares day, I will use the smoke to add more power behind the words in the eyes if the audience, and to show the effects of evil working instantaneously. The chanting will start off slow, quiet and broken. As they progress, eyes never leaving the audience, they will speed up as the evil draws in, and get louder without physically showing the needed exertion for such a volume, hinting at their supernatural intensity. Then they will exit via the ropes, and the carcass will fell through a trapdoor as if buried right into the underworld. Shakespeare would have the witches digging while they chanted, but these personifications of evil were above mortal toil. Shakespeare would also show the power of the witches by having them vanish from the audience, but the assassins will show their power by not seeming to do anything, but they had to be the ones chanting, right? The audience will be asking themselves and by this see them as immortal, above the three dimensions of this reality. And as the stage fades into darkness the scene will end, beginning and starting in the same place; absolute black, suggesting a cycle of evil, which is suggested at the end of the Polanski film as Malcolm approached the witches subsequent to his coronation. This gives the audience that kings come and go, but the controller of this puppet show, the witches, always remains. Since the technology of Shakespeares day could not support the lighting and special effects of modern day theatre, the dialogue of the characters played an important, if not vital, part in the audiences ability to follow the spread of evil. The double meanings of the words reflect the deviousness of evil, and the point of not speaking in iambic pentameters when consumed by evil, for the example the ravings of the mad Lady Macbeth, made it clear where evil has spread while remaining subtle enough not to ruin the mood of the scenes. The echoes of the witches words also represent where evil has touched the characters. It showed the extent of the witches grip on events, and the speed in which their actions take effect. Also, the soliloquised dialogues, primarily Macbeths, show how far evil has reached into his mind and others, changing the way they think, and how they act as well. Shakespeare has cleverly exploited the English language to represent the evil present.

Genetic Variation of Taste Receptors

Genetic Variation of Taste Receptors Abstract: The people have different behaviour to choose the food, and there are many factors that affect the food choices. The best significant factor to choose the food is taste. Differences in taste perception of several taste modalities are associated to difference in the taste receptors. Polymorphisms of the genes that encoding these taste receptors may clarify these unpredictability in taste perception. Individual changes in the capability to identify bitter tasting compounds, such as phenylthiocarbamide (PTC) was a well-known example of this variability. This difference divided the people in two groups: tasters and non-tasters, and is because of in part to single nucleotide polymorphisms (SNP) of a bitter taste receptor gene, taste receptor, type 2 (TAS2R) 38. The experiment was designed to determine the PTC phenotype and genotype, the SNP at position 785 is of particular importance in genotyping. DNA was extracted from check cell by using Chelex technique and genotyped by using polymera se chain reaction (PCR) followed by restriction fragments length polymorphism (PCR-RFLP). A 2% of Agarose gel electrophoresed and stained with Ethidium Bromide to imagine the genotype pattern. The class was tasted PTC test paper to compare phenotype and genotype. The total was 108 students the genotype showed 21 taster (+/+), 51 was mild taster (+/-) and 36 was nontaster (-/-). The allele frequency was not statistically significantly differ from European population. Therefore, TAS2R38 genotype is a truer estimation of the extent of the influence of this single gene on taste perception of PTC in a genetically diverse population. Introduction: Taste perception is the most sensitive predictor of how much a food is pleasant and unpleasant. The people are different in the taste perception of sweet, bitter, sour, or salty tastes which could influence the dietary behaviour (2, 3, 4). The variations in the taste perception between the individuals may relate to a variation in the gene taste receptors (2). The gene family of the taste receptors are encoding from TAS1R and TAS2R. The bitter taste receptors are include the TAS2R38 and TAS2R550. While the umami and sweet taste receptors is the TAS1R. The sour taste receptors are the PKDIL3 and PKD2L1. The genetic variation in these receptors may causes to deferential favourites for some types of food. Phenylthiocarbamide (PTC) compounds is the example was more studied in the variation of the sensitivity of taste as the bitterness (2, 5). The TAS2R38 gene is one of the most studied from over twenty-five in bitter taste receptor gene (4).The TAS2R38 gene is responsible for the taste perception of PTC as more bitter and the other related compounds like 6-n-propylthiouracil (PROP) which both contain a group of thiourea (7.8). The variation in the gene TAS2R38 divided the individuals in two groups of thiourea tasters: tasters and non-tasters (4, 5). Phenylthiocarbamide (PTC) The variation in the taste perception of PTC rely on the genetic studies. In 1930s, difference in the ability to taste PTC was first finding by Arthur L. Fox in a laboratory accidental (6). When he was working in the laboratory and transferring PTC powder into a bottle. Some particles of PTC powder flew into the air and his colleague close to him C. R. Noller tasted the particles as bitter but Fox tasted nothing. Fox was make experiment to test a large number of individuals and he found the difference in their ability to taste PTC and he divided the people in two main groups’ tasters and non-tasters (1). Worldwide about 25% of population classified as ‘non-tasters’ and the remaining 75% as ‘tasters’ (1). In addition, Bartoshuk et al, in 1992, discovered that the ‘tasters’ varied in the perception of PTC/PROP in a bi-modal fashion, and they separated them into medium tasters and supertasters. The supertasters were very sensitive to PTC, pe rceiving them as more bitter, while the medium tasters may taste PTC and found it mild bitter. Besides, the spread of super, medium and non-tasters in the general population is roughly 25%, 50% and 25%, respectively (1). The PTC sensitivity believed to be inherited as a simple Mendelian trait with two alleles a dominant trait (T) for taster and recessive trait (t) for non-taster (9). Figure 1: shows the inheritance of PTC trait. PTC genotype TAS2R38 or PTC gene is located on chromosome 7q and consists of a single coding exon 1002 bp long, encoding 333 amino acids, 7-transmembrane domain G-protein-coupled receptor (2, 6). A number of SNPs have been identified within this gene, the three most common SNPs (>1% of the population has variants at a specific DNA sequence, considered an SNP and (4).Also, the PAV/PAV homozygotes are sensitive to PTC more than PAV/AVI heterozygotes while AVI/AVI homozygotes are fewer sensitive (4). The AVI haplotypes in the non-tester differ at 3 SNPs from the PAV haplotypes of the tasters (9). The aim of this practical: To focus on the TAS2R38 genotype and its link with the ability to taste PTC test paper. The SNP at position 785 is of specific concern in genotyping. Comparing the allele frequency detected in the class with those observed in European population subject in group 226 and Sub-Saharan African subject in group 224. Material and Methods: To determine the TAS2R38 (A262V) genotype by using the polymerase chain reaction (PCR) and restriction endonuclease digestion, Fnu4H1 enzyme. The procedure that has been done was as the following: Protocol of DNA Extraction from Cheek Cell (scrape or wash): First week take a 10 ml of water pour into mouth and swirl to release buccal cells and spit back contents into tube. Centrifuge the tube at 3000rpm for 3 minutes, carefully pour off supernatant and retain cell pellet. Added 350Â µl of 5% Chelex mix and then transfer the pelleted buccal cells to new (1.5ml) Eppendorf tube. The 5% Chelex to protects DNA breakdown under a high temperature. Added 4Â µl of proteinase K to the Eppendorf tube that contains buccal cells and 5% Chelex. Incubated the tube containing chelex/cells at 56Â °C for 30 minutes in the heating block, then briefly vortex the tube for 10 seconds after that centrifuge the tube at 3000rpm for 20 seconds. Incubated the tube ( chelex/cells) again in heating block at 98Â °C for 15 minutes, then vortex the tube for 10 seconds, after that centrifuge for 3minutes.Transferred the supernatant that above the chelex containing the buccal cell (DNA template) into the sterile 1.5ml Eppendorf tube and measured the DNA concentration by take 1Â µl of DNA into machine called nanodrop nucleic acid then kept at -20Â °C to preserve the DNA. Protocol of Phenyl Thiocarbanate(PTC) using PCR Reaction: Second week take a 43.5Â µl of master mix was already prepared in the PCR tube and transferred 6.5Â µl of DNA extraction. (Buccal cell DNA).Vortex and spin the tube to make the liquid contents to bottom of the tube. The total PCR tube reaction volume contain 50Â µl of mixtures were placed in the PCR machine and the thermal cycler conditions were: cycle of 94Â °C for 4 minutes. The 40 cycles of 55Â °C for 40 seconds, 72Â °C for 40 seconds and 94Â °C for 40 seconds .Then 1 cycle of 55Â °C for 5 minutes and at 72Â °C for 5 minutes. The sequence of Forward primer was 5’ AACTGGCAGAATAAAGATCTCAATTTAT3’ The sequence of the Reverse primer was 5’ AACACAAACCATCACCCCTATTTT 3’. Restriction Digestion (Fnu4HI): Last week transferred a 20 ÃŽ ¼l of the component mixture (PCR product) to a tube containing 10ÃŽ ¼l of the restriction endonuclease master. The tube was placed in into a 37Â °C heating block for two hours. Electrophoresis of PCR Products: A 30ml of 2% Agarose gel with 0.5Â µl/ml of ethidium bromide was loaded into the gel tank with adjusting the comb, the gel was kept 15 minutes to get stuck. After that the TBE buffer was loaded, covering the surface of the gel and the comb was removed. Take 12Â µl of PCR product undigested and digested into two different tubes added 3Â µl of DNA loading buffer mix and spin. Then, 10ÃŽ ¼l of PCR product/loading buffer was loaded into the well of 2% Agarose gel and 10ÃŽ ¼l of the ladder (100bp) was added in the last well. The gel electrophoresed at 90 volt for 45minutes, negatively charged (-ve) DNA moved toward the anode side (red). Last take gel photograph under UV trans-illumination. Taste tests: The PTC taste test paper was used to observe the capability to identify the bitterness of PTC and its relative with the TAS2R38 genotype. Statistical analysis: The data of the allele frequency for C785 and T785 observed in the class was compared to the allele frequency of European population subjects in group 226 and Sub-Saharan African subject in group 224 by using the Chi square test. The Chi square test was also used to investigate the association between the TAS2R38 genotype and phenotype. All statistical analyses were performed with Minitab data analysis software. References Feeney E. The impact of bitter perception and genotypic variation of TAS2R38 on food choice. Nutrition Bulletin. 2011; 36(1):20-33. Wooding S, Kim U, Bamshad M, Larsen J, Jorde L, Drayna D. Natural Selection and Molecular Evolution in PTC, a Bitter-Taste Receptor Gene. The American Journal of Human Genetics. 2004; 74(4):637-646. Chaudhari N, Roper S. The cell biology of taste. The Journal of Cell Biology. 2010; 191(2):429-429. Feeney E, OBrien S, Scannell A, Markey A, Gibney E. Genetic variation in taste perception: does it have a role in healthy eating? Proc Nutr Soc. 2010; 70(01):135-143. Lalueza-Fox C, Gigli E, de la Rasilla M, Fortea J, Rosas A. Bitter taste perception in Neanderthals through the analysis of the TAS2R38 gene. Biology Letters. 2009; 5(6):809-811. Kim U, Drayna D. Genetics of individual differences in bitter taste perception: lessons from the PTC gene. Clinical Genetics. 2004; 67(4):275-280. Dotson C, Shaw H, Mitchell B, Munger S, Steinle N. Variation in the gene TAS2R38 is associated with the eating behavior disinhibition in Old Order Amish women. Appetite. 2010; 54(1):93-99. Duffy V, Davidson A, Kidd J, Kidd K, Speed W, Pakstis A et al. Bitter Receptor Gene (TAS2R38), 6-n-Propylthiouracil (PROP) Bitterness and Alcohol Intake. Alcoholism: Clinical Experimental Research. 2004; 28(11):1629-1637. Merritt R, Bierwert L, Slatko B, Weiner M, Ingram J, Sciarra K et al. Tasting Phenylthiocarbamide (PTC): A New Integrative Genetics Lab with an Old Flavor. The American Biology Teacher. 2008; 70(5):e23-e28. Appendix

Wednesday, October 2, 2019

Essay --

The station which might get to be London first shows up in history as a little military space warehouse utilized by the Romans throughout their attack of Britain, which started in A.d. 43. It was conceivably found as an exchanging focus with the landmass and soon formed into a paramount port. It had turned into the base camp of the Procurator, the official responsible for the funds of Roman Britain, when Boudica, the Queen of the Iceni, a local British tribe possessing East Anglia, blazed it to the ground in A.d. 61 over the span of her grisly rebel against Roman guideline. It was reconstructed by the year 100, and first shows up as "Londinium" in Tacitus' Annals. It quickly got to be both the common capital and the regulatory, business, and budgetary focus of Roman Britain. Its populace by the center of the third century numbered maybe 30,000 individuals, a number which developed in fifty years to about twice that number. They existed in a city with cleared boulevards, sanctuaries, open showers, work places, shops, block fields, earthenwares, glass-lives up to expectations, humble homes and fancy estates, encompassed by three miles of stone dividers (allotments of which still remain) which were eight feet thick at their base and up to twenty feet in stature. Throughout the course of the fourth century, nonetheless, as the Roman Empire started to fall, Roman Londinium fell into indistinct quality as its defensive Legions withdrew; history records no hint of it between 457 and 600. Throughout that time, then again, it steadily turned into a Saxon exchanging town, in the long run one of respectable size. In that century Christianity was acquainted with the city (St. Augustine named a diocesan, and a church was constructed), yet th... ...istfulness for a quickly vanishing provincial past which headed William Morris to establish the Society for the Preservation of Ancient Buildings, and headed him, too, to start his The Earthly Paradise with the accompanying lines: Disregard six provinces overhung with smoke, Disregard the grunting steam and cylinder stroke, Disregard the spreading of the repulsive town; Think rather of the pack-horse on the down, What's more long for London, little, and white, and clean, The reasonable Thames flanked by its enclosures green. . . While near the thronged wharf Geoffrey Chaucer's pen Moves over bills of filling. . . From the mid life years on, and well into the nineteenth century, much of London was vicious and dirty. Throughout the eighteenth century, the poor and the unemployed much of the time involved themselves, as Hogarth exhibited, by drink

Tuesday, October 1, 2019

Custom Written Term Papers: Othello’s Involved Imagery :: Othello essays

Othello’s Involved Imagery  Ã‚        Ã‚  Ã‚   The intricate imagery peppering the language of the characters in Shakespeare’s drama Othello is deserving of our detailed consideration in this paper. It has significant meaning, and nearly expresses a life of its own.    The play’s imagery is oftentimes reflective of the fortunes of the protagonist. As the Moor’s status declines, the quality of the imagery in the play declines. In The Riverside Shakespeare Frank Kermode explains the relationship between imagery and Othello’s jealousy:    It is very important to see that Othello’s self-estimate – â€Å"one not easily jealious, but, being wrought, / Perplexed in the extreme† (V.ii.345-46) – is, as Bradley says, â€Å"perfectly just,† and perfectly consistent with the release of unsuspected grossness of language and imagery under the shock of discovering infidelity in the loved one. The peculiar pain of sexual jealousy is deeply involved with the excremental aspect of the sexual organs, and the emotion in betrayal in a supremely intimate trust is involved with agonizing associations of filth and animality. (1200)    A surprising, zoo-like variety of animal injury occur throughout the play. Kenneth Muir, in the Introduction to William Shakespeare: Othello,   explains the conversion of Othello through his increased use of animal imagery:    Those who have written on the imagery of the play have shown how the hold Iago has over Othello is illustrated by the language Shakespeare puts into their mouths. Both characters use a great deal of animal imagery, and it is interesting to note its distribution. Iago’s occurs mostly in the first three Acts of the play: he mentions, for example, ass, daws, flies, ram, jennet, guinea-hen, baboon, wild-cat, snipe, goats, monkeys, monster and wolves. Othello, on the other hand, who makes no use of animal imagery in the first two Acts of the play, catches the trick from Iago in Acts III and IV. The fondness of both characters for mentioning repulsive animals and insects is one way by which Shakespeare shows the corruption of the Moor’s mind by his subordinate. (21-22)    Just how strong a force is the imagery in this drama? Is it more powerful than the chorus in ancient Greek tragedy? H. S. Wilson in his book of literary criticism, On the Design of Shakespearean Tragedy, discusses the influence of the imagery of the play:    It has indeed been suggested that the logic of events in the play and of Othello’s relation to them implies Othello’s damnation, and that the implication is pressed home with particular power in the imagery.

Music in Civil Rights Essay

How did musicians influence the civil rights movement? During the Civil Rights movement of the mid-twentieth century, music was used to spread word of equality and respect in America. Jazz, rock & roll, blues, gospel & reggae music were among the prominent genres of music during this time. With music, African-American artists like Little Richard, Aretha Franklin, and Bob Marley wanted to present positive and uplifting messages to the country that was full of hatred for other people. African Americans also wanted to raise self-confidence of those who were affected by these acts of hate and violence. The music stylings of Jazz and its counterpart Blues played important rolls for music during the Civil Rights Movement. Since the majority of Jazz and Blues singers were black, this music was frowned upon among white southerners. However, it did bring awareness to the mistreatment of Blacks. In the song, â€Å"Strange Fruit† by Billie Holiday, a euphemism is used to represent the bodies of minorities hanging from trees in the south. Jazz music of the twentieth century is known to be told in the stories of the struggle of blacks and others. Along with Jazz and Blues, Gospel and Soul music played a large role in civil rights. Originating from the songs that slaves sang before they were freed, soul and gospel music used religious lyrics to help the nonviolent protest. Similar to jazz and blues, soul and gospel was not likened by many white people as it was primarily performed by black people. One of the most famous black soul singers of all time was Aretha Franklin. She was a key symbol of the advancement of black people, lending her talents to the civil rights cause. She supported Dr. Martin Luther King, as she was close with him and sang at his funeral. This shows her determination for the efforts of the struggle of blacks. A commonly overlooked genre of music which supported civil rights was reggae. It brought up the concept of coming together as one. The artist, Bob Marley was and still is the most known reggae-artist of all time ad his song â€Å"Get Up, Stand Up for Your Rights† showed a message of coming together, despite their skin color or religion. Music written by blacks during the Civil Rights Movement was a large factor in the upbringing of minorities in America. Those who listened to the music were motivated by the lyrics and a message of peace and love among people. This shows that these kinds of music are big parts of the way people think and was powerful enough to strengthen our nation.